When running the Gateway Cloning tool 'Create Expression Clone (LR)' as part of the setup you will select a destination vector.

For a destination vector to be recognized as such apart from the appropriate att sites it must contain the toxin ccdB. This must be present as either 1) a ccdB annotation or 2) the ccdB sequence itself.

1. If the ccdB toxin is represented by an annotation this annotation should be named 'ccdB'. The annotation type is not important, neither is the length of the annotation nor the sequence sitting underneath it.

2. If the ccdB requirement is met by including the ccdB sequence in the vector the sequence must be identical to the sequence below:

The ccdB sequence:

> ATGCAGTTTAAGGTTTACACCTATAAAAGAGAGAGCCGTTATCGTCTGTTTGTGGATGTACAGAGTGATA
TTATTGACACGCCCGGGCGACGGATGGTGATCCCCCTGGCCAGTGCACGTCTGCTGTCAGATAAAGTCTC
CCGTGAACTTTACCCGGTGGTGCATATCGGGGATGAAAGCTGGCGCATGATGACCACCGATATGGCCAGT
GTGCCGGTCTCCGTTATCGGGGAAGAAGTGGCTGATCTCAGCCACCGCGAAAATGACATCAAAAACGCCA
TTAACCTGATGTTCTGGGGAATATAA